| Calling Sequence
| CreateRandSeq(len,F)
|
| Parameters
| | Name | Type | Description |
|
| len
| posint | sequence length |
| F
| array(numeric) | character frequencies |
|
| Return Type
| string |
| Synopsis
| Given a list of frequencies of length 4, this function
creates a random nucleotide sequence of length len. When given a list of
20 (amino acid) frequencies, it generates a random amino acid sequence. A list
of length 64 or 65 produces a random codon sequence without stop codons. |
| Examples
| > CreateRandSeq(20, [0.2, 0.3, 0.4, 0.1]);
AGGCCCCCGGACAAGCGGGA
|
| See also
| CreateRandPermutation, Rand, SetRand, SetRandSeed, Shuffle |